Translate this page into:
Ethanol-Extracted Wenyujin Rhizoma Concisum Ameliorates Acetic Acid-Induced Pain and Improves Associated Central Inflammation by Inhibiting Microglial Inflammatory Activation

*Corresponding author: Prof. Zhenhao Li, Zhejiang Key Laboratory of Biological Breeding and Exploitation of Edible and Medicinal Mushrooms, Wuyi, China. zhenhao6@126.com
-
Received: ,
Accepted: ,
How to cite this article: Wang Y, Hao Y, Pan H, Zhang G, Xu J, He B, et al. Ethanol-Extracted Wenyujin Rhizoma Concisum Ameliorates Acetic Acid-Induced Pain and Improves Associated Central Inflammation by Inhibiting Microglial Inflammatory Activation. Sci Technol Nex 2025;1:47-0. doi: 10.25259/STN_16_2025
Abstract
Objective
This study investigated the analgesic effects and mechanisms of ethanol-extracted (e-WRC) versus water-extracted (w-WRC) Wenyujin Rhizoma Concisum in acetic acid-induced pain.
Material and Methods
Phytochemical analysis using UPLC-QTOF-MS. A mouse pain model was established via acetic acid injection. Writhing responses were assessed following administration of e-WRC or w-WRC (0.6, 3.6 g·kg-1). Cell viability was measured using CCK-8, while gene and protein expression were evaluated by qPCR, Western blot, or immunofluorescence. Transcriptional profiling of LPS-stimulated BV2 cells was conducted by RNA-seq.
Results
UPLC-QTOF-MS analysis confirmed that key anti-inflammatory compounds (furanodiene, curdione, germacrone, curcumin) were exclusively identified in e-WRC. e-WRC reduced writhing (78.67% vs. w-WRC 26.67%) and suppressed TNF-α and Iba-1 expression in brain tissue. In BV2 cells, e-WRC inhibited TNF-α and key inflammatory genes (Ikbke, Nfkbia, Nfkb1, Tlr2, Nlrp3), along with time-dependent downregulation of p-NF-κB.
Conclusion
e-WRC significantly alleviates visceral pain by inhibiting microglial activation and inflammation via the NF-κB and TLR signaling pathways.
Keywords
Inflammation
Pain
Phytochemical profiling
Transcriptomics
Wenyujin rhizoma concisum

1. INTRODUCTION
Pain is a complex sensory and emotional experience that significantly affects quality of life.[1] Over 300 million people in China suffer from pain-related conditions, imposing a substantial economic burden on families and society.[2] Pharmacological therapies, alone or in combination with non-pharmacological approaches, remain the primary strategies for pain management. However, due to the multifaceted nature of pain and the side effects of many analgesics, treatment outcomes are often suboptimal.[3] This underscores the need for effective and well-tolerated therapies.
Pain is generally categorised into somatic, visceral, and central pain, which often coexist.[4] During peripheral inflammation, chemical mediators sensitise nociceptors by lowering the excitation threshold and increasing firing rates, leading to allodynia and hyperalgesia.[5] Inflammatory responses also acidify the tissue microenvironment, stimulating sensory neurons.[5] Notably, peripheral inflammation can influence the central nervous system. Under stress, bone marrow-derived monocytes infiltrate the brain and activate microglia.[6] Additionally, inflammation can compromise the blood-brain barrier, facilitating the entry of immune cells and cytokines into the brain,[6-8] potentially exacerbating central pathologies.[9-11] Therefore, a dual-targeted approach that addresses both peripheral and central inflammation may offer superior pain relief.[12] However, most conventional drugs target a single pathway and are insufficient to address this complexity.
Natural medicines have gained increasing attention due to their multi-target effects and favorable safety profiles.[13,14] Wenyujin Rhizoma Concisum—the dried rhizome of Curcuma wenyujin Y. H. Chen et C. Ling (Zingiberaceae)—has been widely used for its diverse pharmacological properties, including anti-tumor, anti-inflammatory, and analgesic activities.[15] Its processed forms include Curcumae Radix (CRa), Curcumae Rhizoma (CRh), and Wenyujin Rhizoma Concisum (WRC).[15] While CRa and CRh have demonstrated analgesic effects in preclinical models, the pharmacological activity and mechanism of WRC remain underexplored.[16,17]
In this study, we evaluated the analgesic effects of WRC using an acetic acid-induced writhing model and investigated its action mechanisms. Ethanol-extracted WRC (e-WRC) displayed a richer chemical profile and stronger analgesic effects than water-extracted WRC (w-WRC). e-WRC significantly suppressed acetic acid-induced microglial activation and tumor necrosis factor-α (TNF-α) expression in the cortex and hippocampus. Transcriptomic and protein analyses revealed that e-WRC inhibits microglial inflammation through inhibiting NF-κB kinase subunit i/inhibitor of NF-κB/nuclear factor-κB1 (IκKi/IκB/NF-κB1) and toll-like receptor 2/nod-like receptor pyrin domain-containing protein 3 (Tlr2/Nlrp3) pathways, highlighting its potential as a novel multi-target analgesic agent.
2. MATERIAL AND METHODS
2.1. Cell culture and reagents
The mice microglial cells BV2 were purchased from American Type Culture Collection (ATCC, USA). Cells were cultured in DMEM (Bio-Channel, China, Cat: BC-M-005) supplemented with 10% foetal bovine serum (FBS, Genom, China, Cat: GNMFBAD5), 1% penicillin-streptomycin (P/S, Bio-Channel, China, Cat: BC-CE-007), and 1% HEPES buffer (Procell Biotech, China, Cat: PB180325). Lipopolysaccharide (LPS, Solarbio life sciences, China, Cat: 3231030007). Cell Count Kit-8 (CCK-8, MedChemExpress, USA, Cat: 224452). Polyclonal TNF-α antibody (proteintech Technology, China, Cat: 17590-1-AP). Polyclonal p-NF-κB antibody (Abways Technology, China, Cat: CY5095). GAPDH (Cat: db7662), and Goat Anti Rabbit IgG (H+L)-HRP (Cat: db10002) antibodies were purchased from Diag Bio-technology (China). Rotundine (Difeite Pharmaceuticals, China, Cat: 12202341236). Water-extracted Wenyujin Rhizoma Concisum (w-WRC, Batch No: TQ10-220801) and Ethanol-extracted WRC (e-WRC, Batch No: TQ10-220901) were provided by Zhejiang Shouxiangu Pharmaceutical Co., Ltd.
2.2. Compound identification
The compounds of w-WRC and e-WRC were analysed using a Waters ACQUITY I-Class UPLC liquid chromatography and SYNAPT XS mass spectrometer.
Chromatographic conditions. UPLC column (BEH C18 2.1 mm × 100 mm, 1.8 μm), flow rate: 0.4 mL·min-1, injection volume: 1 μL, temperature: 30°C. Mobile phase: water with 0.1% formic acid (MS-grade, A) and acetonitrile (chromatography grade, B). Gradient elution: 0 min, 5% B; 0∼2 min, 5%∼36.5% B; 2∼5 min, 36.5% B; 5∼10 min, 36.5%∼41% B; 10∼14 min, 41%∼57% B; 14∼24 min, 57%∼58% B; 24∼26 min, 58%∼85% B; 26∼28 min, 85%∼100% B.
Mass spectrometry conditions. Flow rate: 700 L·h-1, temperature: 400°C. Scan range: 50 to 1200 m/z, capillary voltage: 3 kV, cone voltage: 30 V, MS collision energy: 20 to 50 V.
The compounds of two extracts were identified through the comparison of their retention time, relative molecular weight, and MS/MS fragments with literature information from CNKI, PubMed, and Reaxys using UNIFI 2.0 software.
2.3. Cell viability assay
BV2 cells were seeded into 96-well plates at a density of 6 × 103 cells in 100 μL DMEM. Cells were treated with different concentrations of e-WRC for 24 h. then, the extract-containing DMEM was removed, and CCK-8-containing (10%) DMEM was added and incubated for 4 h, the absorbance (A) was measured at 450 nm using a microplate reader (Molecular Devices Instrument Inc., CA, USA). The percentage of viability was expressed as (AWRC - Ablank)/(ACon - Ablank) × 100%.[18]
2.4. Effect of e-WRC on LPS-induced microglial inflammatory activation
BV2 cells were seeded in 6-well plates at a density of 2 × 105 cells in 2 mL DMEM. To optimise the incubation time of LPS, cells were treated with LPS (1 μg·mL-1) for 1, 2, 4, 6, 8, 12, 18, 24, and 48 h. In the analysis of the effect of e-WRC on inflammatory activation of microglia, cells were treated with e-WRC (0.75 mg·mL-1) for 6, 12, 18, and 24 h. Then, except the Con group, the other groups were treated with LPS (1 μg·mL-1) for an additional 2 h, and quantitative real-time PCR (qRT-PCR) was performed to detect TNF-α mRNA expression levels.[19]
2.5. RNA isolation and qRT-PCR
Total RNA isolation was performed using the TRIzol reagent (Takara, Japan, Cat: 9108) according to the manufacturer’s protocol. Total RNA quantity and quality were analysed using a NanoDropTM One spectrophotometer (ThermoFisher Scientific, Grand Island, USA). A HiFiScript cDNA Synthesis Kit (CoWin Biotech, China, Cat: 28522) was used to synthesize first-strand cDNA from 1 μg total RNA. qRT-PCR analysis performed using UltraSYBR mixture (CoWin Biotech, China, Cat: 33422) on LightCycler96 Real-Time PCR system (Roche). Primers were designed with Primer3Plus (Cambridge, MA, USA). GAPDH were used as the reference genes. The relative expression of mRNA was calculated by following the previous literature,[20] and the primer sequences were used in qRT-PCR: TNF-α, F: GCCTCCCTCTCATCAGTTCTA and R: GCCTCCCTCTCATCAGTTCTA. GAPDH, F: TGAACGGGAAGCTCACTGG and R: GAGCTTCACAAAGTTGTCATTG.
2.6. Western blotting
Brain tissue and BV2 cells were lysed in ice-cold RIPA buffer (Beyotime Biotechnology, China, Cat: P0013K) supplemented with protease inhibitors, and total protein concentrations were measured by bicinchoninic acid (BCA) protein assay kit (Pierce, USA, Cat: 23228). An equal amount of total protein was separated by SDS-PAGE and transferred to PVDF membrane (Millipore, USA). Blocking with 5% nonfat milk and incubated with the primary antibody overnight at 4°C. TBST washing and incubated with a secondary antibody for 1 h at room temperature (RT). The signals were captured using western lightning Plus-ECL (PerkinElmer, USA, Cat: 203-19031) and iBright 1500 imaging System (Invitrogen, USA). ImageJ 1.41 software (Bethesda, USA) was used for western blot quantitative analysis.[18]
2.7. Acetic acid-induced pain mouse model
Eight-to-ten-week female ICR mice (due to the influence of oestrogen, female mice show a higher sensitivity to pain compared to male mice)[21,22] were purchased from the Laboratory Animal Center of Hangzhou Medical College and maintained in the specific-pathogen-free (SPF) condition after breeding for several days. All animal experiments were approved by the Animal Ethics Committee of Zhejiang Institute of Traditional Chinese Medicine (Approval No: 20220008). All procedures of the experiment are in line with the Animal Welfare Act Regulations.
After 2 weeks of adaptation, the mice (n = 64) were randomly divided by weight into 6 groups: Model group (n = 11, saline), Rotundine group (Rot, n = 11, 48 mg·kg-1), w-WRC low dose group (w-WRC-L, n = 11, 0.6 g·kg-1), w-WRC high dose group (w-WRC-H, n = 11, 3.6 g·kg-1), e-WRC low dose group (e-WRC-L, n = 10, 0.6 g·kg-1), e-WRC high dose group (e-WRC-H, n = 10, 3.6 g·kg-1). Except the Model group, the other groups were given the specified dose of samples by intragastric administration for 7 days (once a day), while the Model group received an equivalent volume of distilled water, and the weight of mice was recorded at day 1, day 3, and day 7. At 30 min after the last sample administration, the mice were intraperitoneally injected with 0.2 mL acetic acid solution (0.6%), and the number (N) of writhing responses was observed and recorded over the next 20 min. The writhing response inhibition (%) was expressed as (NModel - NRwe)/NModel × 100%.[23]
2.8. Brain immunofluorescence
The harvested brain tissues were fixed in 4% paraformaldehyde at 4°C for 12 h, dehydrated, and embedded. Then, the brain tissues were cut into 10-μm sections at 15°C, dried, and pre-cooling at -80°C. Next, the 10-μm slides were fixed in 4% paraformaldehyde for 20 min, and 5% normal goat serum (Solarbio life sciences, China, Cat: SL038) were used for 1 h-blocking. The slides were incubated overnight at 4°C with ionised calcium binding adapter molecule 1 (Iba-1) primary antibodies (Proteintech, USA, Cat: 10904-1-AP). Next, the slides were incubated with FITC-conjugated secondary antibody (Beyotime Biotech, China, Cat: A0562) for 90 min at RT. After washing, slides were stained with DAPI, washed, and mounted with a coverslip.[24] ImageXpress Micro Confocal automated imaging system (Molecular Devices, USA) was used to capture image, and the average fluorescence intensity of FITC was used to indicate the relative expression level of Iba-1.
2.9. RNA-seq analysis
After using FastqQC (v0.11.6) software for quality control, the FASTQ files were aligned to mm10 with Bowtie2 (v2.3.4.3).[25] Resulting SAM files were converted to BAM files with samtools (v1.12).[26] For gene expression quantification, the BAM files processed with featureCounts (v2.0.3).[27] Before further analysis, we used R package edgeR to standardise the gene expression matrix with TMM.[28] Then we performed principal component analysis (PCA), comparison of differentially expressed genes, and functional enrichment analysis.
2.10. Statistical analysis
All results are expressed as mean ± standard deviation (SD) of at least three independent experiments. For analysis with multiple comparisons, one-way analysis of variance (ANOVA) with Dunnett’s correction was used. All analyses were performed using GraphPad Prism (GraphPad Software, Inc., USA), and P < 0.05 was considered as statistically significant.
3. RESULTS AND DISCUSSION
3.1. Phytochemical analysis of w-WRC and e-WRC
The base peak intensity (BPI) spectra, obtained using ultra-performance liquid chromatography-quadrupole time-of-light mass spectrometry (UPLC-QTOF-MS), for w-WRC and e-WRC are shown in Figures 1a and b, respectively. A total of 12 sesquiterpenoids, categorised into bisabolane-type, guaiane-type, and germacrane-type, and five curcuminoid compounds were identified, with compound information detailed in Table 1. Compound-extract distribution analysis revealed seven common components in both w-WRC and e-WRC. These included litseachromolaevane B, (6S)-2-Methyl-6-[(1R,5S)-(4-methene-5-hydroxyl-2-cyclohexen)-2-Hept-en-4-one] isomer (RT: 2.71 min), 8-Hydroxyarturmerone isomer (RT: 2.83 min), procurcumenol, 4-methylene-5-hydroxybisabola-2,10-diene-9-one isomer, ar-turmerone isomer (RT: 5.94 min), and curcumenol isomer. The contents of these compounds were found to be higher in e-WRC than in w-WRC. In addition, several compounds were identified as unique to e-WRC or w-WRC, such as (6S)-2-methyl-6-(4-form-ylphenyl)-2-hepten-4-one and 8-Hydroxyarturmerone isomer (RT: 14 min) in w-WRC, and (6S)-2-Methyl-6-[(1R,5S)-(4-methene-5-hydroxyl-2-cyclohexen)-2-hepten-4-one] isomer, (6S)-2-Methyl-6-[(1R,5S)-(4-methene-5-hydroxyl-2-cyclohexen)-2-hepten-4-one] isomer (RT: 8.73 min), neocurdione, curcumin, curdione, ar-curcumene isomer (RT: 15.57 min), germacrone, and furanodiene in e-WRC.

- Base peak ion (BPI) chromatogram of water-extracted WRC and ethanol extracted WRC using positive ion scanning mode. (a) e-WRC. (b) w-WRC. WRC: Wenyujin Rhizoma Concisum.
| No. | Identification | Formula | Observed positive ion mass (Da) | Error (ppm) | Retention time (min) | Type of compound | Response (counts) | |
|---|---|---|---|---|---|---|---|---|
| w-WRC | e-WRC | |||||||
| 1 | litseachromolaevane B | C15H22O2 | 235.169 | -1.3 | 2.29 | Bisabolane | 24393 | 34666 |
| 2 | (6S)-2-Methyl-6-[(1R,5S)-(4-methene-5-hydroxyl-2-cyclohexen)-2-hepten-4-one] isomer | C15H22O2 | 235.169 | -0.1 | 2.71 | Bisabolane | 11051 | 14596 |
| 3 | 8-Hydroxyarturmerone isomer | C15H20O2 | 233.153 | -1.3 | 2.83 | Curcuminoid | 17218 | 41830 |
| 4 | (6S)-2-methyl-6-(4-formylphenyl)-2-hepten-4-one | C15H18O2 | 231.138 | -1.7 | 2.99 | Bisabolane | 11229 | - |
| 5 | Procurcumenol | C15H22O2 | 235.169 | -1.0 | 3.95 | Guaiane | 7011 | 16537 |
| 6 | 4-methylene-5-hydroxybisabola-2,10-diene-9-one isomer | C15H22O2 | 235.169 | 0.6 | 5.02 | Bisabolane | 26436 | 73375 |
| 7 | Ar-turmerone isomer | C15H20O | 217.158 | -1.8 | 5.94 | Curcuminoid | 8915 | 23778 |
| 8 | (6S)-2-Methyl-6-[(1R,5S)-(4-methene-5-hydroxyl-2-cyclohexen)-2-hepten-4-one] isomer | C15H22O2 | 235.169 | -1.9 | 7.86 | Bisabolane | - | 16381 |
| 9 | (6S)-2-Methyl-6-[(1R,5S)-(4-methene-5-hydroxyl-2-cyclohexen)-2-hepten-4-one] isomer | C15H22O2 | 235.169 | -3.0 | 8.73 | Bisabolane | - | 90949 |
| 10 | Curcumenol isomer | C15H22O2 | 235.169 | -1.4 | 9.47 | Guaiane | 120779 | 627885 |
| 11 | Neocurdione | C15H24O2 | 237.185 | -1.4 | 11.76 | Germacrane | - | 351403 |
| 12 | Curcumin | C21H20O6 | 369.133 | -1.0 | 12.10 | Curcuminoid | - | 6980 |
| 13 | Curdione | C15H24O2 | 237.185 | -1.0 | 12.60 | Germacrane | - | 552328 |
| 14 | 8-Hydroxyarturmerone isomer | C15H20O2 | 233.154 | -0.5 | 14.00 | Curcuminoid | 45233 | - |
| 15 | Ar-curcumene isomer | C15H22 | 203.179 | -2.8 | 15.57 | Curcuminoid | - | 35075 |
| 16 | Germacrone | C15H22O | 219.174 | -1.9 | 17.84 | Germacrane | - | 33061 |
| 17 | Furanodiene | C15H20O | 216.151 | -1.8 | 26.06 | Germacrane | - | 18162 |
WRC: Wenyujin Rhizoma Concisum
3.2. Effect of w-WRC and e-WRC on pain in acetic acid-induced writhing test
As shown in Figure 2a, neither w-WRC and e-WRC treatment affected the body weight of mice. In acetic acid-induced writhing test, compared with the Model group, Rotundine (Rot) reduced the writhing times and number of writhing mice, achieving a writhing inhibition rate of 82.67% [Figures 2b and c]. Among the two extracts, e-WRC demonstrated a more pronounced inhibitory effect on writhing frequency and the number of writhing mice than w-WRC [Figures 2b and c]. Compared with the Model group, high-dose e-WRC (e-WRC-H) reduced the writhing times and number of writhing mice, with a writhing inhibition rate of 78.67% [Figures 2b and c]. It is worth noting that at a given dose, e-WRC-H has a potency close to that of Rot.

- w-WRC and e-WRC ameliorates pain in acetic acid-induced writhing test. (a) Effects of w-WRC and e-WRC on body weight of mice. (b) Effects of w-WRC and e-WRC on writhing times in mice. (c) Effects of w-WRC and e-WRC on the number of writhing mice. left: comparison of number of writhing mice between groups; right: comparison of writhing inhibition rate between groups. (one-way ANOVA with Dunnett’s correction, n = 10∼11). w-WRC: water-extracted Wenyujin Rhizoma Concisum, e-WRC: ethanol-extracted Wenyujin Rhizoma Concisum, L: Low dose group, H: High dose group, SD: Standard deviation.
3.3. Effect of w-WRC and e-WRC on central inflammation in acetic acid-induced writhing test
Inflammatory activation of microglia and TNF-α secretion in the central system drives acetic acid-induced pain.[29] As showed in Figure 3a-c, both Rot and e-WRC-H notably reduced the expression of TNF-α (P < 0.01) compared with the Model group.

- w-WRC and e-WRC inhibit central inflammation in acetic acid-induced mice pain model. (a) effects of w-WRC and e-WRC on TNF-α mRNA expression in mouse brain tissues (n = 3). (b-c) effects of w-WRC and e-WRC on TNF-α protein expression in mouse brain tissues (b) and semi-quantitative analysis (c) (n = 3). (d-f) Effects of w-WRC and e-WRC on Iba-1 protein expression (d, ×200) in cortex (e) and hippocampus (f), and relative quantitative analysis (n = 11∼28). (one-way ANOVA with Dunnett’s correction, * P < 0.05, ** P < 0.01, *** P < 0.001 compared with the Model group). w-WRC: water-extracted Wenyujin Rhizoma Concisum, e-WRC: ethanol-extracted Wenyujin Rhizoma Concisum.
Since microglia serves as major producers of TNF-α, directly promoting central inflammation,[30] we concentrated our analysis on the impact of e-WRC on the expression of microglial inflammatory activation marker Iba-1 in brain tissues. As shown in Figure 3d-f, both Rot and e-WRC-H reduced Iba-1 expression in cortex and hippocampal regions compared to the Model group (P < 0.01), as indicated by a notable reduction in the Iba-1-FITC fluorescence intensity.
3.4. e-WRC inhibits LPS-induced TNF-α mRNA expression in BV2 cells
As reported in the literature, TNF-α expression levels exhibit significant fluctuations in macrophages.[31] As shown in Figure 4a, qRT-PCR results indicated that 2-h LPS treatment maximally increased TNF-α mRNA expression levels in BV2 cells.

- e-WRC inhibits LPS-induced inflammatory activation in BV2 cells. (a) Effect of LPS on TNF-α mRNA expression in BV2 cells. (b) Effect of e-WRC treatment for 24 h on the activity of BV2 cells. (c) Effect of e-WRC treatment for 4, 8, 16, and 24 h on TNF-α mRNA expression in BV2 cells. (d-e) Effect of e-WRC treatment for 4, 8, 16, and 24 h on TNF-α protein expression in BV2 cells (d) and semi-quantitative analysis (e). (one-way ANOVA with Dunnett’s correction, *** P < 0.001 compared with the Con group; ## P < 0.01, ### P < 0.001 compared with the LPS group, n = 3). w-WRC: water-extracted Wenyujin Rhizoma Concisum, e-WRC: ethanol-extracted Wenyujin Rhizoma Concisum, LPS: Lipopolysaccharide and TNF-α: Tumor necrosis factor-α.
Subsequently, we determined the non-toxic dosage range of e-WRC for BV2 cells. As shown in Figure 4b, the highest non-toxic concentrations of e-WRC for BV2 cells were up to 0.75 mg·mL-1. We then examined the effect of e-WRC on TNF-α expression levels in BV2 cells. As shown in Figure 4c-e, compared with the Con group, LPS treatment significantly increased TNF-α expression levels (P < 0.001). Compared with the LPS group, pre-treatment with e-WRC for 4, 8, 16, and 24 h significantly deceased TNF-α expression levels in BV2 cells (P < 0.01).
3.5. e-WRC inhibits LPS-induced inflammatory activation by inhibiting the NF-κB signaling pathway in BV2 cells
Next, we utilised transcriptome sequencing technology to further elucidate the potential mechanism by which e-WRC inhibits inflammatory activation of BV2 cells. As shown in Figure 5a, PCA indicated that both LPS and e-WRC significantly altered gene expression in BV2 cells. Specifically, LPS significantly up-regulated 423 genes and down-regulated 109 genes compared to the Con group, while e-WRC significantly up-regulated 442 genes and down-regulated 137 genes [Figure 5b]. Notably, 196 genes showed reverse regulation by LPS and e-WRC [Figure 5c]. Gene ontology (GO) analysis showed that these reversely regulated genes were primarily enriched in responses to molecules of bacterial origin, cellular responses to molecules of bacterial origin, cellular responses to LPS, and IκB kinase/NF-κB signaling [Figure 5d]. Furthermore, KEGG analysis indicated that these biological processes were mainly involved in TNF, IL-17, NF-κB, and TLR signaling pathways [Figure 5e]. Ultimately, our analysis the effect of e-WRC on the expression levels of TLR- and NF-κB-related inflammatory pathways. As shown in Figure 5f-g, compared with the Con group, LPS treatment significantly increased IκBke, NF-κBia, NF-κB1, Tlr2, and Nlrp3 mRNA expression levels (P < 0.01). Compared with the LPS group, e-WRC significantly inhibited the expression of IκBke, NF-κBia, NF-κB1, Tlr2, and Nlrp3 mRNA in BV2 cells (P < 0.05). Given the important role of NF-κB signaling pathway in inflammation induction, we analysed the effect of e-WRC on NF-κB protein expression. As shown in Figure 5h-i, e-WRC time-dependently inhibited p-NF-κB expression in BV2 cells.

- Effect of e-WRC on transcription profile in BV2 cells. (a and b) PCA (a) and differential expression analysis of transcriptome sequencing data (b). (c) Venn diagram of genes co-regulated by LPS and e-WRC. (d and e) GO (d) and KEGG (e) analysis of genes co-regulated by LPS and e-WRC. (f and g) Effect of e-WRC on the expression of IκKi/IκB/NF-κB1 (f) and Tlr2/Nlrp3 (g) signaling pathways. (h and i) Effect of e-WRC on the expression of p-NF-κB protein in BV2 cells (h) and semi-quantitative analysis (i). (one-way ANOVA with Dunnett’s correction, ** P < 0.01, *** P < 0.001 compared with the Con group; # P < 0.05, ### P < 0.001 compared with the LPS group, n = 3). WRC: Wenyujin Rhizoma Concisum, PCA: Primary component analyse, KEGG: Kyoto Encyclopedia of Genes and Genomes, p-NF-κB: Nuclear factor kappa-B.
3.6 Discusion
We show that e-WRC, but not w-WRC, reproducibly attenuates acetic-acid induced writhing-a validated model of acute inflammatory pain[32]-by blocking microglia-driven central inflammation through suppression of NF-κB and TLR signaling.
The phytochemical composition of traditional Chinese medicine (TCM) is closely related to its pharmacological effects.[33] WRC is one of the medicinal parts of C. wenyujin, exhibits pharmacological effects such as antioxidation, anti-inflammation and anti-tumor.[34] Modern drug analysis studies have shown that WRC contains various chemical components such as sesquiterpenes, monoterpenes, diterpenes and curcuminoids.[34] However, there are significant differences in the chemical composition of different sources of WRC. For instance, the average contents of four quality evaluation-related components, namely neocurdione, curdione, germacrone and furanodiene of WRC sourced from Zhejiang are higher than those in Fujian, Yunnan and Anhui.[35] In our research, we found that the phytochemical composition of e-WRC is more diverse than that of w-WRC. Notable, several compounds, such as furanodiene, curdione, germacrone, and curcumin, are specific to e-WRC, have demonstrated potential anti-inflammatory activity in vitro and in vivo.[36-39] Conversely, the low abundance of procurcumenol in w-WRC may explain why its efficacy in alleviating acetic acid-induced pain is significantly lower than that of e-WRC.
Inflammation is the amplifier of pain, and chronic pain can exacerbate inflammation, namely neurgenic inflammation.[40] Acetic acid is known to trigger both visceral nociception and peripheral leucocyte recruitment,[41] recent work further documents elevated NLRP3 inflammasome expression in the prefrontal cortex,[29] implicating central inflammation. Consistent with this, we observed increased TNF-α mRNA and protein in whole-brain homogenates and up-regulation of the microglial activation marker Iba-1 in cortex and hippocampus. e-WRC reversed these neuro-inflammatory signatures, whereas w-WRC remained inactive, indicating that suppression of central-rather than only peripheral-inflammation is required for measurable analgesia.
Blood-brain barrier (BBB) is a natural protective membrane that shields the central nervous system from external toxins and pathogens. However, the existence of the BBB complicates the treatment of central nervous system diseases, and using lipophilic molecules as drug carriers is an ideal strategy for achieving central targeting.[42] Notably, the phytochemical analysis revealed that e-WRC contains a greater variety of lipid-soluble compounds compared to w-WRC [Table 1]. The central nervous system (CNS) is typically isolated from the peripheral circulation containing inflammatory mediators and immune cells by the BBB.[43] However, excessive and dysregulated peripheral inflammation can disrupt BBB homeostasis through mechanisms, such as inducing central sensitisation and increasing BBB permeability,[44,45] leading to transmission of inflammatory signals between the periphery and the CNS, and contributing to or exacerbating a range of neurological diseases.[46,47] From a therapeutic perspective, the increased BBB permeability during intense inflammation may allow lipid-soluble compounds to enter the CNS and exerts local therapeutic effects. Consequently, in states of heightened inflammation, e-WRC may more readily reach the CNS to suppress central inflammation and alleviate acetic acid-induced pain. Whether e-WRC additionally stabilises BBB tight junctions or solely benefits from heightened permeability remains to be determined.
Once affecting the CNS, e-WRC modulates microglial innate signalling. Microglial activation is governed by convergent TLR, NLRP and JAK/STAT pathways.[48-50] Among these, TLR2 ligation triggers sequential NF-κB and NLRP3 inflammasome assembly.[51,52] We found that e-WRC effectively decreased the mRNA and/or proteion expression levels of IκBke, NF-κBia, NF-κB1, Tlr2, and Nlrp3, which are pivotal for the regulation of IκKi/IκB/NF-κB1 and Tlr2/Nlrp3 inflammatory signaling pathways.[53,54] These findings suggest that e-WRC directly targets microglia to suppress the activation of inflammatory pathways, thereby inhibiting central inflammation.
4. CONCLUSION
In conclusion, e-WRC exerts its therapeutic effects against acetic acid-induced pain by suppressing microglial inflammatory activation via inhibition of NF-κB and TLR signaling pathways. These findings collectively position e-WRC as a promising, mechanism-driven analgesic candidate, providing a robust theoretical foundation for targeting neuroinflammatory components in visceral pain disorders. Future investigations should prioritise validating its efficacy in advanced visceral pain models and exploring clinical translation for pain management.
Acknowledgements
We acknowledge Zhejiang Research Institute of Traditional Chinese Medicine for its laboratory equipment.
Ethical approval
The research/study approved by the Institutional Review Board at Zhejiang Institute of Traditional Chinese Medicine Co., Ltd, number 20220008, dated June 10th, 2022.
Declaration of patient consent
Patient’s consent not required as there are no patients in this study.
Financial support and sponsorship
This study was financially supported by Central Guiding Local Science and Technology Development Fund Project (2024ZY01009) and Zhejiang Provincial Key R&D Program: Vanguard and Leading Goose Initiative (2025C01133).
Conflicts of interest
There are no conflicts of interest.
Use of artificial intelligence (AI)-assisted technology for manuscript preparation
The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.
References
- Critical Care Nursing Clinics of North America. 2017;29:407-18.
- [CrossRef] [PubMed]
- Pain Management Nursing. 2019;20:365-72.
- [CrossRef] [PubMed]
- Journal of Controlled Release. 2018;269:189-213.
- [CrossRef] [PubMed]
- Nebraska Nurse. 2010;43:8-9.
- CNS Neuroscience Therapeutics. 2016;22:88-101.
- [CrossRef] [PubMed] [PubMed Central]
- Progress in Neuro-Psychopharmacology Biological Psychiatry. 2017;79:40-48.
- [CrossRef] [PubMed]
- EMBO Reports. 2018;19
- BMC Anesthesiol. 2021;21:79.
- [CrossRef] [PubMed] [PubMed Central]
- Modern Trends in Pharmacopsychiatry. 2013;28:175-87.
- [CrossRef] [PubMed]
- Molecular and Cellular Neurosciences. 2013;53:6-13.
- [CrossRef] [PubMed]
- The European Journal of Neuroscience. 2020;52:2791-814.
- [CrossRef] [PubMed] [PubMed Central]
- Brain, Behavior, and Immunity. 2016;57:38-46.
- [CrossRef] [PubMed]
- Nature Reviews. Drug Discovery. 2021;20:200-16.
- [CrossRef] [PubMed] [PubMed Central]
- Journal of Computer-Aided Molecular Design. 2022;36:363-371.
- [CrossRef] [PubMed] [PubMed Central]
- Journal of Ethnopharmacology. 2021;269:113689.
- [CrossRef] [PubMed]
- Frontiers in Pharmacology. 2022;13:926291.
- [CrossRef] [PubMed] [PubMed Central]
- BMC Complementary and Alternative Medicine. 2014;14:346.
- [CrossRef] [PubMed] [PubMed Central]
- Scientific Reports. 2025;15:22111.
- [CrossRef] [PubMed] [PubMed Central]
- Phytomedicine. 2023;108:154545.
- [CrossRef] [PubMed] [PubMed Central]
- Cell Death Disease. 2019;10:456.
- [CrossRef] [PubMed] [PubMed Central]
- Nature Neuroscience. 2015;18:1081-1083.
- [CrossRef] [PubMed] [PubMed Central]
- Cephalalgia. 2023;43:3331024221136286.
- [CrossRef] [PubMed]
- Integrative Cancer Therapies. 2015;14:282-290.
- [CrossRef] [PubMed]
- Phytomedicine. 2023;110:154626.
- [CrossRef] [PubMed]
- Nature Methods. 2012;9:357-359.
- [CrossRef] [PubMed] [PubMed Central]
- Bioinformatics. 2009;25:2078-2779.
- [CrossRef] [PubMed] [PubMed Central]
- Bioinformatics. 2014;30:923-930.
- [CrossRef] [PubMed]
- Bioinformatics. 2010;26:139-140.
- [CrossRef] [PubMed] [PubMed Central]
- Journal of Neuroscience. 2017;37:871-881.
- [CrossRef] [PubMed] [PubMed Central]
- Neurochemistry International. 2013;63:47-53.
- [CrossRef] [PubMed] [PubMed Central]
- Alcoholism, Clinical and Experimental Research. 2019;43:425-438.
- [CrossRef] [PubMed] [PubMed Central]
- Pharmacology, Biochemistry, and Behavior. 2012;101:320-328.
- [CrossRef] [PubMed]
- Phytomedicine. 2021;86:153558.
- [CrossRef] [PubMed]
- Zhongguo Zhong Yao Za Zhi. 2023;48:5419-5437.
- [CrossRef] [PubMed]
- Phytochemical Analysis. 2025;36:1231-1244.
- [CrossRef] [PubMed]
- Current Pharmaceutical Design. 2021;27:2628-2634.
- [CrossRef] [PubMed]
- International Immunopharmacology. 2023;118:110082.
- [CrossRef] [PubMed]
- International Immunopharmacology. 2023;124:110876.
- [CrossRef] [PubMed]
- Frontiers in Immunology. 2022;13:891822.
- [CrossRef] [PubMed] [PubMed Central]
- Current Medicinal Chemistry. 2020;27:1444-1445.
- [CrossRef] [PubMed]
- Journal of Pain Research. 2021;14:1201-14.
- [CrossRef] [PubMed] [PubMed Central]
- Signal Transduction and Targeted Therapy. 2023;8:217.
- [CrossRef] [PubMed] [PubMed Central]
- CNS Neuroscience Therapeutics. 2021;27:36-47.
- [CrossRef] [PubMed] [PubMed Central]
- Experimental Gerontology. 2018;107:59-66.
- [CrossRef] [PubMed]
- Neurobiology of Aging. 2013;34:2064-2070.
- [CrossRef] [PubMed]
- Journal of Cerebral Blood Flow and Metabolism. 2023;43:622-641.
- [CrossRef] [PubMed] [PubMed Central]
- Brain, Behavior, and Immunity. 2023;111:202-210.
- [CrossRef] [PubMed]
- Science. 2025;388:eadx0043.
- [CrossRef] [PubMed]
- Inflammopharmacology. 2021;29:965-974.
- [CrossRef] [PubMed] [PubMed Central]
- Molecular Brain. 2022;15:73.
- [CrossRef] [PubMed] [PubMed Central]
- Frontiers in Oncology. 2022;12:834072.
- [CrossRef] [PubMed] [PubMed Central]
- Molecular immunology. 2019;105:62-75.
- [CrossRef] [PubMed]
- Nature Microbiology. 2023;8:958-972.
- [CrossRef] [PubMed] [PubMed Central]
- The FEBS Journal. 2016;283:2259-2271.
- [CrossRef] [PubMed]
